| Primary Identifier | MGI:7490402 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ccdc27 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATGGGTGTCTAGATAGCTG and CTTCTGATGGAGGGTTGGGA, which resulted in a 757 bp deletion beginning at Chromosome 4 position 154,039,447 bp and ending after 154,040,203 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000332415 (exon 4) and 602 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 140 and early truncation 63 amino acids later. |
