| Primary Identifier | MGI:7491695 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gm13889 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGGGCCGAGTCGGAGTCGC and CATCCGAGCTTGCAGCCGTG, which resulted in a 707 bp deletion beginning at Chromosome 2 position 93,956,403 bp and ending after 93,957,109 bp (GRCm38/mm10). This mutation deletes 707 bp from ENSMUSE00000643086 (exon 1) and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 6 amino acids later. |
