|  Help  |  About  |  Contact Us

Allele : Rr49<em1Axvi> regulatory region 49; endonuclease-mediated mutation 1, Axel Visel

Primary Identifier  MGI:7489586 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr49
Strain of Origin  FVB Is Recombinase  false
Is Wild Type  false
molecularNote  The topologically associating domain (TAD) boundary region or insulator between Smad3 and Smad6, separating the Smad3 TAD from the Smad6 TAD, was targeted with sgRNAs (targeting CCTTATTGAACAGGCATCCACGG, GCTTTAAAGGGGAGACCTGAGGG, GAGTGAAACTGGGGGAATCGGGG and AGCTTGACTTAGCTACTTTGAGG) using CRISPR/Cas9 technology, resulting in an 80742 bp deletion (chr9:63749007-63829748 (GRCm39)).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • B1,
  • B1
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories