| Primary Identifier | MGI:7489590 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr53 |
| Strain of Origin | FVB | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The topologically associating domain (TAD) boundary region or insulator between Sim1 and Lilrb4b, separating the Sim1 TAD from the Rfx6 TAD, was targeted with sgRNAs (targeting TATAGCTGAATAAGTATACAGGG, TGAACTTGAACAGAGAAATGGGG, CTTGTTGCCTGCTCTGTAGGTGG and TGATTGGTAGGAGCAGAAACAGG) using CRISPR/Cas9 technology, resulting in a 19621 bp deletion (chr10:51280274-51299894 (GRCm39)). |
