Primary Identifier | MGI:7489591 | Allele Type | Endonuclease-mediated |
Attribute String | Modified regulatory region | Gene | Rr55 |
Strain of Origin | FVB | Is Recombinase | false |
Is Wild Type | false |
molecularNote | The topologically associating domain (TAD) boundary region or insulator between Tbx3 and Tbx5, separating Tbx3 the TAD from the Tbx5 TAD, was targeted with sgRNAs (targeting TGCTGAGTCACACCTACAAGCGG, ATCCAGTGTTGAGCCAACCTAGG, ATTGCTCTCTGCGTTGCTGACGG and GTCTCTGAGACCCGTTATCCCGG) using CRISPR/Cas9 technology, resulting in a 33864 bp deletion (chr5:119848470-119882333 (GRCm39)). |