|  Help  |  About  |  Contact Us

Allele : Rr55<em1Axvi> regulatory region 55; endonuclease-mediated mutation 1, Axel Visel

Primary Identifier  MGI:7489591 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr55
Strain of Origin  FVB Is Recombinase  false
Is Wild Type  false
molecularNote  The topologically associating domain (TAD) boundary region or insulator between Tbx3 and Tbx5, separating Tbx3 the TAD from the Tbx5 TAD, was targeted with sgRNAs (targeting TGCTGAGTCACACCTACAAGCGG, ATCCAGTGTTGAGCCAACCTAGG, ATTGCTCTCTGCGTTGCTGACGG and GTCTCTGAGACCCGTTATCCCGG) using CRISPR/Cas9 technology, resulting in a 33864 bp deletion (chr5:119848470-119882333 (GRCm39)).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • B5,
  • B5
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

3 Publication categories