|  Help  |  About  |  Contact Us

Allele : Rr52<em1Axvi> regulatory region 52; endonuclease-mediated mutation 1, Axel Visel

Primary Identifier  MGI:7489594 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr52
Strain of Origin  FVB Is Recombinase  false
Is Wild Type  false
molecularNote  The topologically associating domain (TAD) boundary region or insulator between Fam241a and Pitx2, separating the Neurog2 TAD from the Pitx2 TAD, was targeted with sgRNAs (targeting TCACTACATCGAGTAGAACCCGG, GACATCAGTTGTAGAAAACACGG, ATCTCAAGTTAAGGGTCTGTGGG and CATCTCAAGTTAAGGGTCTGTGG) using CRISPR/Cas9 technology, resulting in a 34240 bp deletion (chr3:127763934-127798173 (GRCm39)).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • B7,
  • B7
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

2 Publication categories