| Primary Identifier | MGI:7489595 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr56 |
| Strain of Origin | FVB | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The topologically associating domain (TAD) boundary region or insulator between Dmrt3 and Dmrt2, separating the Dmrt1/Dmrt3 TAD from the Dmrt2 TAD, was targeted with sgRNAs (targeting GAACAAGCAAGTGGGTATAAGGG, GAAAATACACTGTTTTGGGAGGG, AATCAGATATGAACGCACCAGGG and CGCACCAGGGAGCAGTATAGGGG) using CRISPR/Cas9 technology, resulting in an 11374 bp deletion (chr19:25603698-25615071(GRCm39)). |
