|  Help  |  About  |  Contact Us

Allele : Rr56<em1Axvi> regulatory region 56; endonuclease-mediated mutation 1, Axel Visel

Primary Identifier  MGI:7489595 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr56
Strain of Origin  FVB Is Recombinase  false
Is Wild Type  false
molecularNote  The topologically associating domain (TAD) boundary region or insulator between Dmrt3 and Dmrt2, separating the Dmrt1/Dmrt3 TAD from the Dmrt2 TAD, was targeted with sgRNAs (targeting GAACAAGCAAGTGGGTATAAGGG, GAAAATACACTGTTTTGGGAGGG, AATCAGATATGAACGCACCAGGG and CGCACCAGGGAGCAGTATAGGGG) using CRISPR/Cas9 technology, resulting in an 11374 bp deletion (chr19:25603698-25615071(GRCm39)).
  • mutations:
  • Intergenic deletion
  • synonyms:
  • B8,
  • B8
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele