|  Help  |  About  |  Contact Us

Allele : Tbx5<em1Vmc> T-box 5; endonuclease-mediated mutation 1, Vincent M Christoffels

Primary Identifier  MGI:7491981 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Tbx5
Strain of Origin  FVB Is Recombinase  false
Is Wild Type  false
molecularNote  Glycine codon 125 (GGC) was changed to arginine (CGC) (p.G125R) using sgRNAs (targeting TAGGCCTTCATGTAGGTCCGTAAC and AAACGTTACGGACCTACATGAAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with Holt–Oram syndrome (HOS) or hand–heart syndrome.
  • mutations:
  • Single point mutation
  • synonyms:
  • Tbx5<G125R>,
  • Tbx5<G125R>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories