| Primary Identifier | MGI:7491981 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Tbx5 |
| Strain of Origin | FVB | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Glycine codon 125 (GGC) was changed to arginine (CGC) (p.G125R) using sgRNAs (targeting TAGGCCTTCATGTAGGTCCGTAAC and AAACGTTACGGACCTACATGAAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with HoltâOram syndrome (HOS) or handâheart syndrome. |
