| Primary Identifier | MGI:7491749 | Allele Type | Endonuclease-mediated |
| Attribute String | Not Specified | Gene | Inha |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 233 (CGT) in exon 2 was changed to alanine (GCG) (ENSMUST00000037330.5:c.697_699delinsGCG p.R233A) using an sgRNA (targeting GCACGGAGGGAGTTGAACGC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.R232A that blocks the inhibin function of the encoded peptide but preserves activin A/B production. |
