| Primary Identifier | MGI:7718424 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr124 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Foxp3 enhancer CNS2 was targeted using sgRNAs (AGACAGAAUCGAUAGAACUU and GAGCACUUCAAAAGUGACCA) with CRISPR/Cas9 technology, resulting in a 548 bp deletion (GRCm39:chrX:7450192-7450739). This allele was created in zygotes that contain the Foxp3tm11.2Ayr allele, where enhancer CNS0 has been deleted and a GFP reporter gene fused inline to the 5' end of the Foxp3 CDS. |
