|  Help  |  About  |  Contact Us

Allele : Ly6l<em1(IMPC)Tcp> lymphocyte antigen 6 family member L; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7524667 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ly6l
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGGAGGCATGATGGTCAACG and ATGGTCATTGGGCAATACTC targeting from within exons ENSMUSE00000960385 to ENSMUSE00000952793. This resulted in a 1738-bp deletion of Chr15 from 75321375 to 75323112 (GRCm39) and a 40 bp insertion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories