|  Help  |  About  |  Contact Us

Allele : Igs85<em1Pero> intergenic site 85; endonuclease-mediated mutation 1, Pedro P Rocha

Primary Identifier  MGI:7718679 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Igs85
Strain of Origin  C57BL/6NCr Is Recombinase  false
Is Wild Type  false
molecularNote  The following 321 bp concatenation of three CTCF-binding-motif-containing sequences (in this order) was inserted between GRCm39:chr3:34778989 and 34778990 using an sgRNA (equivalent to CCTGTGCTGTACCTAATAGTAGC) and an ssODN template using CRISPR/Cas9 technology: reverse complement of GRCm39:chr8:13511990-13512089, chr1:34257543-34257652 and reverse complement of chr4:132978080-132978190.
  • mutations:
  • Insertion
  • synonyms:
  • CTCFi3x<+>,
  • CTCFi3x<+>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories