| Primary Identifier | MGI:7718679 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Igs85 |
| Strain of Origin | C57BL/6NCr | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The following 321 bp concatenation of three CTCF-binding-motif-containing sequences (in this order) was inserted between GRCm39:chr3:34778989 and 34778990 using an sgRNA (equivalent to CCTGTGCTGTACCTAATAGTAGC) and an ssODN template using CRISPR/Cas9 technology: reverse complement of GRCm39:chr8:13511990-13512089, chr1:34257543-34257652 and reverse complement of chr4:132978080-132978190. |
