| Primary Identifier | MGI:7493276 | Allele Type | Endonuclease-mediated |
| Attribute String | Hypomorph | Gene | Iars1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6JJcl |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Valine codon 79 (GTT) in exon 3 was changed to leucine (CTT) (NM_172015.3:c.235G>C, p.V79L) using a crRNA (targeting TGTCAACGTGAAACCCGCTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is associated with weak calf syndrome in cattle. |
