|  Help  |  About  |  Contact Us

Allele : Runx1<em1Salr> runt related transcription factor 1; endonuclease-mediated mutation 1, Stephen A Liebhaber

Primary Identifier  MGI:7495608 Allele Type  Endonuclease-mediated
Attribute String  Modified isoform(s) Gene  Runx1
Strain of Origin  (C57BL/6J x SJL/J)F2 Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing is used to delete exon 6. The intron 5 sgRNA (Runx1E6_gRNA.254, GGGCACCGAGTCCCAGACTG) was designed to target chromosome 16 (Chr 16) coordinates 92644590 to 92644609 (Mus musculus genomic assembly mm10) and the intron 6 sgRNA (Runx1E6_gRNA.121, GAAACCCCGCAGCATCAGCT) targeted to Chr 16, positions 92644031 to 92644050.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Runx1deltaE6,
  • Runx1deltaE6
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories