| Primary Identifier | MGI:7520045 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ddx17 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTATTCTGAAAAATTACAAG and CTATCTTTACTAGTAAACTA, which resulted in an 820 bp deletion beginning at Chromosome 15 position 79,540,391 bp and ending after 79,541,210 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000260669 and ENSMUSE00000557611 (exons 4 and 5) and 620 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 100 and early truncation 18 amino acids later. |
