| Primary Identifier | MGI:7520066 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Hypomorph | Gene | Tmem161b |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Tryptophan codon 317 (TGG) in exon 10 was changed to arginine (CGT) (c.949_951delTGGinsCGT, p.W317R) using an sgRNA (targeting CATTTGATACTCTTCGACTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.949C>T:p.W317R mutation associated with polymicrogyria (PMG). |
