|  Help  |  About  |  Contact Us

Allele : Wdr24<em1Jiguo> WD repeat domain 24; endonuclease-mediated mutation 1, Jianping Guo

Primary Identifier  MGI:7520408 Allele Type  Endonuclease-mediated
Gene  Wdr24 Strain of Origin  C57BL/6
Is Recombinase  false Is Wild Type  false
molecularNote  Serine codon 155 (TCT) in exon 1 was changed to alanine (GCT) (p.S155A) using an sgRNA (targeting GTGCTTTGACCTCCGAAGGAAGG and GACTCTGTCAGCACCTTCTCTGG) and an ssODN template with CRISPR/Cas9 technology. This mutation changes the affected residue in the encoded peptide from phosphorylatable to a phosphoblocker.
  • mutations:
  • Single point mutation
  • synonyms:
  • Wdr24<S155A>,
  • Wdr24<S155A>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories