| Primary Identifier | MGI:7511843 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Mc4r |
| Strain of Origin | FVB/NJ | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Valine codon 103 (GTC) in exon 1 was changed to isoleucine (ATC) (p.V103I) using an sgRNA (CCGUAUCCGUACUGUUUAAC) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics the same human variant associated with protection against obesity and increased adiposity in people of European descent. |
