|  Help  |  About  |  Contact Us

Allele : Pigk<em1Linwu> phosphatidylinositol glycan anchor biosynthesis, class K; endonuclease-mediated mutation 1, Lingqian Wu

Primary Identifier  MGI:7511851 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Pigk
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  A single nucleotide (T) insertion into exon 1 was created using an sgRNA (targeting TCTCTCGGCAGCTCTGCCGC) and an ssODN template with CRISPR/Cas9 technology, resulting in a reading frame shift and premature stop codon (c.87_88insT, p.I30Yfs*10). The mutation mimics the same human mutation associated with severe infantile encephalopathy.
  • mutations:
  • Insertion
  • synonyms:
  • Pigk<I30fs>,
  • Pigk<I30fs>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories