| Primary Identifier | MGI:7511851 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Pigk |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A single nucleotide (T) insertion into exon 1 was created using an sgRNA (targeting TCTCTCGGCAGCTCTGCCGC) and an ssODN template with CRISPR/Cas9 technology, resulting in a reading frame shift and premature stop codon (c.87_88insT, p.I30Yfs*10). The mutation mimics the same human mutation associated with severe infantile encephalopathy. |
