| Primary Identifier | MGI:7511852 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Pigk |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Aspartic acid codon 204 (GAC) in exon 7 was changed to histidine (CAC) (p.D204H) using an sgRNA (targeting GTTCATTATTGACACTTGCC) and an ssODN template with CRISPR/Cas9 technology. The mutation mimics the same human mutation associated with severe infantile encephalopathy. |
