|  Help  |  About  |  Contact Us

Allele : Pigk<em2Linwu> phosphatidylinositol glycan anchor biosynthesis, class K; endonuclease-mediated mutation 2, Lingqian Wu

Primary Identifier  MGI:7511852 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Pigk
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Aspartic acid codon 204 (GAC) in exon 7 was changed to histidine (CAC) (p.D204H) using an sgRNA (targeting GTTCATTATTGACACTTGCC) and an ssODN template with CRISPR/Cas9 technology. The mutation mimics the same human mutation associated with severe infantile encephalopathy.
  • mutations:
  • Single point mutation
  • synonyms:
  • Pigk<D204H>,
  • Pigk<D204H>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele