|  Help  |  About  |  Contact Us

Allele : Clcc1<em2Yiji> chloride channel CLIC-like 1; endonuclease-mediated mutation 2, Yichang Jia

Primary Identifier  MGI:7520605 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Clcc1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Tryptophan codon 267 (TGG) in exon 8 (ENSMUST00000106609) or 9 (ENSMUST00000029483) was changed to arginine (CGG) (p.W267R) using an sgRNA (targeting TTGGCATGGGTCATCCTTATAGG ) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation found in amyotrophic lateral sclerosis (ALS) patients.
  • mutations:
  • Single point mutation
  • synonyms:
  • Clcc1 W267R,
  • Clcc1 W267R
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories