| Primary Identifier | MGI:7520605 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Clcc1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Tryptophan codon 267 (TGG) in exon 8 (ENSMUST00000106609) or 9 (ENSMUST00000029483) was changed to arginine (CGG) (p.W267R) using an sgRNA (targeting TTGGCATGGGTCATCCTTATAGG ) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation found in amyotrophic lateral sclerosis (ALS) patients. |
