|  Help  |  About  |  Contact Us

Allele : Clcc1<em3Yiji> chloride channel CLIC-like 1; endonuclease-mediated mutation 3, Yichang Jia

Primary Identifier  MGI:7520606 Allele Type  Endonuclease-mediated
Gene  Clcc1 Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Lysine codon 298 (AAG) in exon 8 (ENSMUST00000106609) or 9 (ENSMUST00000029483) was changed to alanine (GCG) (p.K298A) using an sgRNA (targeting TTGGTTGGTTCCACCAACAAAGG) and an ssODN template with CRISPR/Cas9 technology. The affected residue is evolutionary conserved and critical for the channel function of the encoded peptide.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Clcc1 K298A,
  • Clcc1 K298A
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories