| Primary Identifier | MGI:7520606 | Allele Type | Endonuclease-mediated |
| Gene | Clcc1 | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Lysine codon 298 (AAG) in exon 8 (ENSMUST00000106609) or 9 (ENSMUST00000029483) was changed to alanine (GCG) (p.K298A) using an sgRNA (targeting TTGGTTGGTTCCACCAACAAAGG) and an ssODN template with CRISPR/Cas9 technology. The affected residue is evolutionary conserved and critical for the channel function of the encoded peptide. |
