| Primary Identifier | MGI:7512774 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Lrp4 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 1170 (CGG) in exon 25 was changed to tryptophan (TGG) (c.3508C>T, p.R1170W) using an sgRNA (targeting CCCCGGGCCATTGTATTATACCAT) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics a human mutation associated with a sclerosteosisâlike phenotype. |