|  Help  |  About  |  Contact Us

Allele : Lrp4<em1Alegr> low density lipoprotein receptor-related protein 4; endonuclease-mediated mutation 1, Alexander G Robling

Primary Identifier  MGI:7512774 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Lrp4
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 1170 (CGG) in exon 25 was changed to tryptophan (TGG) (c.3508C>T, p.R1170W) using an sgRNA (targeting CCCCGGGCCATTGTATTATACCAT) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics a human mutation associated with a sclerosteosis‐like phenotype.
  • mutations:
  • Single point mutation
  • synonyms:
  • Lrp4 R1170W,
  • Lrp4<KI>,
  • Lrp4<KI>,
  • Lrp4 R1170W
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories