| Primary Identifier | MGI:7544953 | Allele Type | Endonuclease-mediated |
| Gene | Ntrk1 | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Arginine codon 685 (CGA) in exon 15 was changed to alanine (GCC) (p.R685A) using a crRNA (targeting AAGGTTTAGGGACACTTACTCGG) and an ssODN template with CRIPSR/Cas9 technology. The mutation abolishes PTP1B binding and, consequently, NTRK1 dephosphorylation. |
