|  Help  |  About  |  Contact Us

Allele : Ntrk1<em1Krvl> neurotrophic tyrosine kinase, receptor, type 1; endonuclease-mediated mutation 1, Rejji Kuruvilla

Primary Identifier  MGI:7544953 Allele Type  Endonuclease-mediated
Gene  Ntrk1 Strain of Origin  C57BL/6J
Is Recombinase  false Is Wild Type  false
molecularNote  Arginine codon 685 (CGA) in exon 15 was changed to alanine (GCC) (p.R685A) using a crRNA (targeting AAGGTTTAGGGACACTTACTCGG) and an ssODN template with CRIPSR/Cas9 technology. The mutation abolishes PTP1B binding and, consequently, NTRK1 dephosphorylation.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • TrkA<R685A>,
  • TrkA<R685A>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele