|  Help  |  About  |  Contact Us

Allele : Pah<em1Auma> phenylalanine hydroxylase; endonuclease-mediated mutation 1, Aurora Martinez

Primary Identifier  MGI:7512826 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Pah
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 261 (CGA) in exon 7 was changed to glutamine (CAA) (c.782 G>A, p.R261Q) using an sgRNA (targeting AGTGGAAGACTCGGAAGGCCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation mimics the same human mutation associated with phenylketonuria (PKU).
  • mutations:
  • Single point mutation
  • synonyms:
  • Pah-R261Q,
  • Pah-R261Q
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories