| Primary Identifier | MGI:7512826 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Pah |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 261 (CGA) in exon 7 was changed to glutamine (CAA) (c.782 G>A, p.R261Q) using an sgRNA (targeting AGTGGAAGACTCGGAAGGCCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation mimics the same human mutation associated with phenylketonuria (PKU). |
