| Primary Identifier | MGI:7513990 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready, No functional change | Gene | Phf12 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences TTAGGCGCATACACAGCGCA and AACCTTTGATGCGCTTCTCC and two single-strand oligonucleotides encoding loxP sites. This inserted loxP sites after Chr11:77900073 and Chr11:7790072, flanking exon ENSMUSE00000339213. An additional sequence was inserted after the proximal (5') loxP site after Chr11:77900077 corresponding to a duplication of Chr11:77900015 to 77900047 in reverse orientation. |
