|  Help  |  About  |  Contact Us

Allele : Zfp276<em1(IMPC)J> zinc finger protein (C2H2 type) 276; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7513907 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp276
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGCAAATGTGACATAAGCG and GATGGTTTACAGGTTAGCAG, which resulted in a 2961 bp deletion beginning at Chromosome 8 position 123,255,684 bp and ending after 123,258,644 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001238666, ENSMUSE00001307651, ENSMUSE00001236036, ENSMUSE00000215264 and ENSMUSE00001232446 (exons 2-6) and 2000 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 70 and early truncation 60 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories