|  Help  |  About  |  Contact Us

Allele : Slc37a4<em3Lutzy> solute carrier family 37 (glucose-6-phosphate transporter), member 4; endonuclease-mediated mutation 3, Cathy Lutz

Primary Identifier  MGI:7541201 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Slc37a4
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing used guide RNAs (GGGATATTTTAGGAGCCTGA, ATATTTTAGGAGCCTGAGGG, ATTCCTTCGCCTACATCCAG, TTGCCACTGGATGTAGGCGA) to excise and replace murine exon 3 with a loxP-flanked wild type exon 3 cassette. This exon 3 delted mutation is an indel. Slc37a4 transcript Slc37a4-201 (ENSMUST00000165839.3) was used as reference for the exon number and guide sequences.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Slc37a4 Exon 3 KO,
  • Slc37a4 Exon 3 KO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories