| Primary Identifier | MGI:7541201 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc37a4 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 genome editing used guide RNAs (GGGATATTTTAGGAGCCTGA, ATATTTTAGGAGCCTGAGGG, ATTCCTTCGCCTACATCCAG, TTGCCACTGGATGTAGGCGA) to excise and replace murine exon 3 with a loxP-flanked wild type exon 3 cassette. This exon 3 delted mutation is an indel. Slc37a4 transcript Slc37a4-201 (ENSMUST00000165839.3) was used as reference for the exon number and guide sequences. |
