|  Help  |  About  |  Contact Us

Allele : Wbp1<em1(IMPC)Tcp> WW domain binding protein 1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7541412 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Wbp1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCTCCTAGAACACGCCTGAA targeting within ENSMUSE00001230083 and CCTGCCCGGCCCATCGCCAC targeting within ENSMUSE00000804494. The resulting 2221-bp deletion of Chr6 from 83096136 to 83098356 (GRCm39) deletes the full coding region.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories