| Primary Identifier | MGI:7541412 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Wbp1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCTCCTAGAACACGCCTGAA targeting within ENSMUSE00001230083 and CCTGCCCGGCCCATCGCCAC targeting within ENSMUSE00000804494. The resulting 2221-bp deletion of Chr6 from 83096136 to 83098356 (GRCm39) deletes the full coding region. |