| Primary Identifier | MGI:7526140 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Polr1a |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Cysteine codon 1559 (TGC) in exon 31 was changed to phenylalanine (TTC) (c.4676G>T, p.C1559F) using an sgRNA (targeting TGTTGGTCGTTTCGTTCAGGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the rare human POLR1A c.4685G>T (p.Cys1562Phe) mutation associated with craniofacial, neural, and cardiac anomalies. |