|  Help  |  About  |  Contact Us

Allele : Polr1a<em1Knwea> polymerase (RNA) I polypeptide A; endonuclease-mediated mutation 1, Kathryn Nicole Weaver

Primary Identifier  MGI:7526140 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Polr1a
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Cysteine codon 1559 (TGC) in exon 31 was changed to phenylalanine (TTC) (c.4676G>T, p.C1559F) using an sgRNA (targeting TGTTGGTCGTTTCGTTCAGGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the rare human POLR1A c.4685G>T (p.Cys1562Phe) mutation associated with craniofacial, neural, and cardiac anomalies.
  • mutations:
  • Single point mutation
  • synonyms:
  • Polr1a<C1559F>,
  • Polr1a<C1559F>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories