| Primary Identifier | MGI:7526160 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Kcnn3 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/cas9 genome editing used guide RNAs (GAAATGCCAACACTAAGCCT, AAATGCCAACACTAAGCCTG, ATGCACTCAGTAGGGGCATT, and CATGCACTCAGTAGGGGCAT) to insert a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence) upstream of a mutant exon 5 with a valine to phenylalanine (V556F, GTG to TTT) substitution at position 556 in the gene. The mutation is located in the HA helix. PAM deletion mutations to eliminate recutting with CRISPR/cas9 were inserted in intron 4 and 5. Kcnn3 transcript Kcnn3-201 (ENSMUST00000000811.7) was used as reference for the exon number and guide sequences. The orthologous clinical V555F gain of function mutation is associated with ZimmermannâLaband Syndrome (VLS), a cranial malformation syndrome. Cre-mediated recombination removed the LSL cassette. |
