| Primary Identifier | MGI:7526309 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hmgxb4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAACATTCTCCAGTCACAG and ACATACTGTAACCTAGGCTG, which resulted in a 365 bp deletion beginning at Chromosome 8 position 75,020,168 bp and ending after 75,020,532 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001311661 (exon 6) and 283 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 398 and early truncation 21 amino acids later. |
