| Primary Identifier | MGI:7526370 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc25a33 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGCACCCCAGATACCTTG and GCATGAACATCCAGGTGCAG, which resulted in a 501 bp deletion beginning at Chromosome 4 position 149,753,556 bp and ending after 149,754,056 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000184185 (exon 4) and 400 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 104 and early truncation 14 amino acids later. |
