|  Help  |  About  |  Contact Us

Allele : Commd3<em1Ksuz> COMM domain containing 3; endonuclease-mediated mutation 1, Kazuhiro Suzuki

Primary Identifier  MGI:7526088 Allele Type  Endonuclease-mediated
Gene  Commd3 Strain of Origin  C57BL/6
Is Recombinase  false Is Wild Type  false
molecularNote  Cysteine codon 170 (TGC) was changed to alanine (GCC) (p.C170A) using an sgRNA (targeting GATTAATTTTAGTTGCAACA) and an ssODN template with CRISPR/Cas9 technology. The affected residue is located in the COMM domain of the encoded peptide, which is involved in complex formation with COMMD8. This mutation abrogates the inhibitory effect of celastrol on the COMMD3/8 complex.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • COMMD3<C170A>,
  • COMMD3<C170A>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories