| Primary Identifier | MGI:7526125 | Allele Type | Endonuclease-mediated |
| Gene | Dpysl2 | Strain of Origin | FVB |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Threonine codon 555 (ACC) in exon 14 was changed to alanine (GCC) (c.1663A>G, p.T555A) using a crRNA (targeting GGGTGCCACGATGCGCTGGGTGG) and an ssODN tempate with CRISPR/Cas9 technology. The mutation replaces a phosphorylatable residue in the encoded peptide with a phosphoblocker. |
