|  Help  |  About  |  Contact Us

Allele : Dpysl2<em1Jpka> dihydropyrimidinase-like 2; endonuclease-mediated mutation 1, Josef P Kapfhammer

Primary Identifier  MGI:7526125 Allele Type  Endonuclease-mediated
Gene  Dpysl2 Strain of Origin  FVB
Is Recombinase  false Is Wild Type  false
molecularNote  Threonine codon 555 (ACC) in exon 14 was changed to alanine (GCC) (c.1663A>G, p.T555A) using a crRNA (targeting GGGTGCCACGATGCGCTGGGTGG) and an ssODN tempate with CRISPR/Cas9 technology. The mutation replaces a phosphorylatable residue in the encoded peptide with a phosphoblocker.
  • mutations:
  • Single point mutation
  • synonyms:
  • CRMP2-T555A,
  • CRMP2<ki>,
  • CRMP2-T555A,
  • CRMP2<ki>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele