Primary Identifier | MGI:7526145 | Allele Type | Endonuclease-mediated |
Attribute String | Humanized sequence | Gene | Polr1a |
Strain of Origin | C57BL/6 | Is Recombinase | false |
Is Wild Type | false |
molecularNote | Proline codon 1635 (CCT) in exon 33 was changed to leucine (CTT) (c.4904C>T, p.P1635L) using an sgRNA (targeting GCCACCAGGGAGAGATGGCGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the rare human POLR1A c.4913C>T (p.Pro1638Leu) mutation associated with craniofacial, neural, and cardiac anomalies. This allele also contains an unintended c.4895C>T (p.A1632V) mutation in cis. |