| Primary Identifier | MGI:7520866 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Tmem98 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Alanine codon 193 (GCT) in exon 7 was changed to proline (CCT) (ENSMUST00000040865:c.577G>C, p.A193P) using an sgRNA (targeting CCAATCACTGTCTGCCGCTG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with nanophthalmos. |
