|  Help  |  About  |  Contact Us

Allele : Tmem98<em1Siggs> transmembrane protein 98; endonuclease-mediated mutation 1, Owen M Siggs

Primary Identifier  MGI:7520866 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Tmem98
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Alanine codon 193 (GCT) in exon 7 was changed to proline (CCT) (ENSMUST00000040865:c.577G>C, p.A193P) using an sgRNA (targeting CCAATCACTGTCTGCCGCTG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with nanophthalmos.
  • mutations:
  • Single point mutation
  • synonyms:
  • Tmem98<A193P>,
  • Tmem98<A193P>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele